Pay in 4 interest-free payments of $6.02 Learn more
Ships within 48 hours · Estimated delivery Aug 18 - Aug 23
Without the savings card, costs vary by plan and may range from $50-$500 per month depending on your copay or coinsurance
We used the GSTM3 forward primer GGAGGCAAGGGACGGAGA and reverse primer TTCCGAGCCTTCGAGGACTAG
The source of a peptide does not affect its compatibility with other compounds
Getting Help from a Pharmacist or Healthcare Provider A pharmacist can give advice if tirzepatide may have been frozen
US$ 20.23
US$ 22.32
US$ 22.03
US$ 22.88
US$ 28.20
US$ 28.17
US$ 26.40
US$ 24.98
US$ 25.01
